Use of 2T TA PCR in HPV16 diagnostic model

Information about Use of 2T TA PCR in HPV16 diagnostic model

Published on February 7, 2008

Author: Siro

Source: authorstream.com

Content

Slide1:  Use of 2T-TA PCR in HPV-16 diagnostic model Slide2:  Experiment in HPV-16 model to establish: Effect of extended primers and initial high temperature cycling on sensitivity of standard reaction Detection capabilities of 2T-TA Experimental outline: 1. Amplification of amplicon / target with standard & 2T-TA primers 2. Detection of target in genomic DNA background 3. Detection of amplicon in genomic DNA background 4. Detection of amplicon & target in genomic DNA background HPV-16 2T-TA: outline HPV-16 2T-TA: background:  HPV-16 2T-TA: background Standard F primer: ATGAAATAGATGGTCCA Standard R primer: GCAACAAAAGGTTACAA 2T-TA F primer: GCACGCCGAGAGAAGAGACATGAAATAGATGGTCCA 2T-TA R primer: GCACGTCCGCTGTGACTGTCGCAACAAAAGGTTACAA HPV16 target DNA mimic (92bp): AGCTCAGAGGAGGAGGATGAAATAGATGGTCCAGCTGGACAAGCAGAACCGGACAGAGC CCATTACAATATTGTAACCTTTTGTTGCAAGTG Human genomic DNA 50ng/ml (Promega Corporation) LightCycler 1.2 (Roche Applied Sciences) FastStart SYBR Green I Master Mix (Roche Applied Sciences) HPV-16 2T-TA: PCR product Tm and size:  HPV-16 2T-TA: PCR product Tm and size 2T-TA primer product Standard primer product 34bp 67bp 110bp Standard product 2T-TA product Size marker 5% agarose gel Expected sizes of PCR products: Standard primers 71bp 2T-TA primers 110bp HPV-16 2T-TA :Amplification of target and amplicon DNA with standard and 2T-TA primers:  HPV-16 2T-TA :Amplification of target and amplicon DNA with standard and 2T-TA primers HPV-16 2T-TA: Detection of amplicon with 2T-TA primers and 72°C annealing:  HPV-16 2T-TA: Detection of amplicon with 2T-TA primers and 72°C annealing Dilution series: 108 to 102 copies amplicon DNA NTC 95°C 10 min x 1 95°C 10 sec 72°C 20 sec x40 Cycling parameters: HPV-16 2T-TA: Detection of HPV-16 target DNA in background of human genomic DNA:  HPV-16 2T-TA: Detection of HPV-16 target DNA in background of human genomic DNA Increased efficiency with extended primers HPV-16 2T-TA: Detection of amplicon in background of human genomic DNA:  HPV-16 2T-TA: Detection of amplicon in background of human genomic DNA NTC Dilution series: 105 to 101 copies amplicon DNA 95°C 10 min x 1 95°C 10 sec 70°C 0 sec x40 77°C 25sec Cycling parameters: HPV-16 2T-TA: Detection of single copy amplicon:  HPV-16 2T-TA: Detection of single copy amplicon 95°C 10 min x 1 95°C 10 sec 70°C 0 sec x45 77°C 25sec 95 °C 10 sec 47°C 0 sec x40 77°C 25sec Cycling parameters: 70°C annealing 47°C annealing Amplicon only 103 102 101 100 100 amplicon only No amplification was seen at dilution of 10-1 copies amplicon DNA Fraction of 100 amplicon samples detected to contain amplicon was consistent with distribution of single copies. Conclusion is that 2T-TA method detected single copy amplicon HPV-16 2T-TA: Detection of amplicon in the presence of target DNA:  HPV-16 2T-TA: Detection of amplicon in the presence of target DNA 95°C 10 min x 1 95°C 10 sec 70°C 0 sec x45 77°C 25sec 95 °C 10 sec 47°C 0 sec x40 77°C 25sec Cycling parameters: 70°C annealing 47°C annealing Amplicon Target 103 106 102 106 101 106 106 target only HPV-16 2T-TA: Detection of amplicon in mixtures of amplicon and target :  HPV-16 2T-TA: Detection of amplicon in mixtures of amplicon and target 95°C 10 min x 1 95°C 10 sec 70°C 0 sec x45 77°C 25sec 95 °C 10 sec 47°C 0 sec x40 77°C 25sec Cycling parameters: Crossing points are the same for varying levels of target Detection of single copy amplicon HPV-16 2T-TA: Crossing point for detection of target is not altered by initial high temperature cycles :  HPV-16 2T-TA: Crossing point for detection of target is not altered by initial high temperature cycles HPV-16 2T-TA: Summary:  HPV-16 2T-TA: Summary 2T-TA PCR can detect single copy of amplicon DNA in background of human genomic DNA Crossing point for target DNA was not affected by high temperature cycles in 2T-TA PCR, suggesting optimised 2T-TA PCR will have equivalent sensitivity to standard PCR Experiment needs to be repeated in the context of further optimised clinical diagnostic model Slide14:  Magdalen Centre The Oxford Science Park Oxford SX4 4GA [email protected] direct dial: +44 (0) 7771 802713

Related presentations


Other presentations created by Siro

industry shampoo
13. 01. 2008
0 views

industry shampoo

communication skills
28. 01. 2008
0 views

communication skills

OzoneDepletion
20. 02. 2008
0 views

OzoneDepletion

Wine Tour 07
06. 02. 2008
0 views

Wine Tour 07

Samsung Electronics Master
08. 04. 2008
0 views

Samsung Electronics Master

2 ARV access EMRO Survey
08. 05. 2008
0 views

2 ARV access EMRO Survey

Leap for London assembly Primary
02. 05. 2008
0 views

Leap for London assembly Primary

4Unit 1
24. 04. 2008
0 views

4Unit 1

LateralThinking
16. 04. 2008
0 views

LateralThinking

poole
21. 03. 2008
0 views

poole

SOLUTIONS 2007 Conference Guide
19. 03. 2008
0 views

SOLUTIONS 2007 Conference Guide

RutgersTB2
15. 03. 2008
0 views

RutgersTB2

JHP a FRBR ENG
11. 03. 2008
0 views

JHP a FRBR ENG

delta777
09. 01. 2008
0 views

delta777

bentivegna thesis04
10. 01. 2008
0 views

bentivegna thesis04

DetroitScience Center
10. 01. 2008
0 views

DetroitScience Center

michigan0319a
13. 01. 2008
0 views

michigan0319a

asso 12b25
14. 01. 2008
0 views

asso 12b25

Intro overview
16. 01. 2008
0 views

Intro overview

d000511
18. 01. 2008
0 views

d000511

Solar Water Pumps in Kansas
23. 01. 2008
0 views

Solar Water Pumps in Kansas

trt8fm
17. 01. 2008
0 views

trt8fm

Psalms Class 1
04. 02. 2008
0 views

Psalms Class 1

Deuteronomy6Sermon
04. 02. 2008
0 views

Deuteronomy6Sermon

Cellular Phones
04. 02. 2008
0 views

Cellular Phones

AIG PTF March 03
04. 02. 2008
0 views

AIG PTF March 03

TSIL Shareholders 160606
11. 02. 2008
0 views

TSIL Shareholders 160606

102
21. 01. 2008
0 views

102

20050717 worship
29. 01. 2008
0 views

20050717 worship

jiyeong0414
10. 01. 2008
0 views

jiyeong0414

MEMS
13. 02. 2008
0 views

MEMS

01 rlsss
25. 02. 2008
0 views

01 rlsss

MD SuDeChallenges TTBe
09. 01. 2008
0 views

MD SuDeChallenges TTBe

Laura Gitlin
16. 01. 2008
0 views

Laura Gitlin

DBillington
11. 01. 2008
0 views

DBillington

4 Nakatani
24. 01. 2008
0 views

4 Nakatani

GRD MatE
22. 01. 2008
0 views

GRD MatE

e0
05. 02. 2008
0 views

e0

Presentation23
11. 01. 2008
0 views

Presentation23

FAUVE PORTRAITS
26. 02. 2008
0 views

FAUVE PORTRAITS